Name

ID Cs8g04110.1
Description Endo-1,4-beta-xylanase F1; Endo-1,4-beta-xylanase C; Endo-1,4-beta-xylanase A; Probable endo-1,4-beta-xylanase C; Probable endo-1,4-beta-xylanase F1;Hydrolase, hydrolyzing O-glycosyl compounds, putative
SwissProt Endo-1,4-beta-xylanase A
Locus
Cs8g04110
Link GBrowse, PPI

Homolog

Orthologs AT4G33830.1 [Arabidopsis_thaliana]
AT4G33840.1 [Arabidopsis_thaliana]
AT4G33860.1 [Arabidopsis_thaliana]
LOC_Os03g10478.1 [Oryza_sativa]

Gene Ontology & InterPro Entry

Gene Ontology
GO:0003824[molecular_function]catalytic activity
GO:0004553[molecular_function]hydrolase activity, hydrolyzing O-glycosyl compounds
GO:0005975[biological_process]carbohydrate metabolic process
GO:0016798[molecular_function]hydrolase activity, acting on glycosyl bonds
GO:0043169[molecular_function]cation binding
InterPro Entry
IPR001000Glycoside hydrolase, family 10
IPR003305Carbohydrate-binding, CenC-like
IPR008979Galactose-binding domain-like
IPR013781Glycoside hydrolase, catalytic domain
IPR017853Glycoside hydrolase, superfamily

Domain analysis

> Graphic

> Table

Gene3D
2.60.120.260Galactose-binding domain-like
3.20.20.80Glycosidases
HMMPanther
PTHR31490FAMILY NOT NAMED
HMMPfam
PF00331Glyco_hydro_10
PF02018CBM_4_9
HMMSmart
SM00633Glycosyl hydrolase family
superfamily
SSF49785Galactose-binding domain-like
SSF51445(Trans)glycosidases

RNA fold

>Cs8g04110.1 transcript(len:1828) -520.71
ATGAAATTATCTACGGGTCAGAGAACGCGCGGGCTTGAAGCTAATGCATTAACAACTTACGATTACACTGCCACCATTGAGTGTTTGGAA
AAGCCTCACAAACCTCAATACGGTGGAGGAATCATAAAAAACCCAGAGCTAAGTCATGGCTTGAAAGGATGGTCTGCATTTGGAAATGCA
AAAATAGAACAAAGAGAATCAGGAGGCAACAAATTCTTGGTGGCTCATAGCAGAAGCCAGCCATACGACAGCATCTCGCAGAAAGTTTAT
TTGGAAAAGAACAAATTTTACACTCTCTCTGCGTGGATTCAAGTGAGTGAGGGGGCCGCTCCAGTAACTGCCGTTTTCAAAACAATTACT
GGGTTTAAGCATGCTGGTGCGGCTGTTGCCGAGTCGAAATGCTGGTCCATGCTTAAGGGTGGTCTGTCACCAGATGCATCAGGCTTTGCT
GAGCTCTATTTCGAGAGCAAGAACACCTCTGTTGACATTTGGGTGGATAGTATTTCTTTACAACCATTCACTCAAGAAGAGTGGAGGTCG
CAGCAACATCAAAGCATTGAGAAGAATCATAAAACAAATGTGAGAATCCAAGCAGTTGATAAACAAGGCAAGCCTCTTCAGAACGCGAAT
ATCTCCATTGAACAGAAGCAACTACGATTCCCATTTGGTTGTGCAATAAACAAAAACATCCTCACCAACACAGCCTACCAAAATTGGTTC
ACTTCAAGGTTTAAAGTCACTACCTTTGAAGATGAAATGAAATGGTACAGCACTGAAGCTTCCCCTGGCCGAGAAGACTACTCAACCTCT
GATGCCATGCTTCAATTTGCCAAGAACCACAACATAGCAGTCCGAGGCCACAATATCTTTTGGGAGGATCCGCGCTACCAACCCGGATGG
GTCAATTCACTCTCTCCGAGTGATCTTTCTAAGGCTGCTGATAAGAGAATCAATTCCATTACGTCAAGATACAAGGGCCAAGTTATTGCT
TGGGATGTTGTTAATGAGAATCTGCACTTTTCTTTCTTCGAAAGCAAGCTAGGGCAAGATGCTTCGGGTGTTTTCTTCAACAGAGTTCAT
AGTTTAGATGGAGCTACCACATTGTTTATGAATGATTACAATACTATTGAAGACAGTAGAGATGGGAAGGCAACACCAGCTACGTACTTA
CAAAAGCTGAGGCAAATCAGCCAATTTCCCGGTAACCAAAATCTGCGGATTGGCATTGGACTAGAGTCTCACTTCAGTACTCCAAATATC
CCCTACATGAGAGCTTCTATAGACACACTTGGTGCCACAGGGTTACCCATTTGGCTTACAGAAGTTGATGTTCAAAGCAGCCCTAATCAG
GCGCAGTACTTGGAACAGATTTTAAGAGAGGCACATGCTCACCCAAAGGTTCAAGGAATTGTAGTTTGGGCAGCATGGAAACCAAGTGGG
TGTTACAGGATGTGTTTAACTGACAACAATTTCAAGAATTTAGCAACTGGGGATGTTGTAGACAAGCTCTTGCATGAATGGGGCTCTAAG
AGGTTGGAAGGGAAGACAGATGCTGATGGTTTTTTCGACACCACACTTTTCCATGGAGACTACGAAGTGAAGATCACTCGACAGGCCGCT
AATACCATCTTCTCCATGGCTCAAAGCTTTAAGGTGCTTCCTACAAATGCATCTCAAACAATATCAATGCTTATCAAAGTCTCTGCATAG
TGCCCCTAAATTCTTTTAATTTAGGTTTGTTTATTAATTTTAAATAAAATTATAAGGGGTAGATAATCTTTTTATAAGAAAGTATCAAAG
TAAGCAGAAGAGATTACCAAAATCAATT

>Cs8g04110.1 transcript(len:1828) -520.71
.(((.........((((..((((...(((((((((((((((....(((((....((((((..........(((((((((((.(((((((.
.....)).)))))))))))..)))))..(((((...........((((((..(((((((((.....((....(((((.((((......))
))...........(((.((((((((........))))))))..)))...)))))..))))))))..)))))).)))((((((.((...((
(((........)))))........)).))))))..)))))..))))))(((((((((..((((((((.((............)).)))))
)))....(((((..(((..((((....))))..)))..))))))))))........(((((((((.((.((((..((.((((((((((((
..(((((......))))).........((((((....(((((((((((.(((......)))....)))))))))))...(((((((((((
(......(((((.((.(((.((....(((((.......)))))...)))))))..))))).....(((....))).........))))..
.)))))))).))))))))))).........(((((((((((((.........................))))))).((((....))))((
((((((((((...........))).)))))).)))....))))))...))).)))).)).....))))..))..)))))))))..)))).
)))))...)))))))...)))..................((((....((.(((......))))).)))).))))).....((((....))
)).......)))).)))).(((((((((...(((((..(((((((................................((((((....)))
)))(((((((((..(((((...((((...((((..((((...(((...(((..((((((.((((..((((((.(((((......((((((
((....((((.........))))..))))))))..........((((((....))))))......))))).))))))..((((.......
.....(((((((.......(((((..((((((..........))).))))))))...((((....))))..)))))))......((((((
(((....((..((.((((.((((((((((((..(((....)))(((((((((((......((((((..(((((.(((..(((((....))
).))....))).)))))))))))..........((((((..((((((....(((....)))...)))))).))))))....)))))))))
))...)))).))))))))...((........)).)))).))..))...)))))))))))))..)))))))))).....))).)))....)
)))..))))((((((((....(((..((((.........)))).......(((((((((...(((.(((.....))))))...((.....
....))....))))))))).....)))......)).)))))).....))))))))))))))))))....))))))).)))))((((....
(((((((.....((........)).((((((((.......))))))))......)))))))((((.((((.....))))...))))....
...)))).))))))))).....)))...

5'3'

PROTEIN fold

1
91
181
271
361
451
541
90
180
270
360
450
540
630

Gene expression in the RNA-seq Data